LINFLEUCOSI CRNICA

Sarcoma

CREA UN NUOVO MESSAGGIO.

Ma sei un utente non autorizzato.

Se ti sei registrato prima, quindi "accedi" (modulo di accesso nella parte in alto a destra del sito). Se questa è la tua prima volta qui, registrati.

Se ti registri, sarai in grado di tracciare le risposte ai tuoi messaggi in futuro, continuare il dialogo in argomenti interessanti con altri utenti e consulenti. Inoltre, la registrazione ti consentirà di condurre una corrispondenza privata con consulenti e altri utenti del sito.

Oncologia

Una diagnosi preliminare è la leucemia linfatica cronica, basata su un esame del sangue. Inviato all'ematologo (non è ancora andato, ferie e tutto il resto).

Emoglobina 145,
Globuli bianchi 23.6,
Metamilocociti 4,
Pugnale 5,
Segmentato 17,
Linfociti 79.

In generale, vorrei sapere che tipo di malattia è questa: leucemia linfatica cronica? E, soprattutto, quali sono le previsioni per trattarlo in Israele??

Buon pomeriggio! La leucemia linfocitica cronica presenta un'ampia diagnosi differenziale e richiede ulteriori studi, come la biopsia del midollo osseo e esami del sangue avanzati. Se, in effetti, questa diagnosi è confermata, la prognosi è abbastanza buona. Con il giusto trattamento, i pazienti vivono per decenni e si sentono bene.

Ciao ciao. ".. un'ampia diagnosi differenziale.." - questo è come capire nella traduzione nel linguaggio ordinario?

cioè, se la diagnosi è confermata, viene trattata facilmente? Per determinare con precisione la diagnosi, quali test sono necessari? Forse ha senso per noi venire da te con i risultati? E in media, al prezzo e al tempo per la diagnosi e il trattamento, di quanti soldi hai bisogno? Sarà possibile, ad esempio, sottoporsi a diagnosi e fare iniezioni a casa?

Un'ampia diagnosi differenziale significa che ci sono molte malattie in cui possono esserci tali esami del sangue e l'obiettivo principale è fare una diagnosi.
Non consiglio di fare test in Russia, perché la cosa più importante per il risultato del trattamento è una diagnosi corretta.
Non c'è niente in mezzo. Il medico deve ricevere tutti i documenti e parlare al paziente per telefono. Successivamente, inviamo un piano d'esame e spieghiamo, quando possibile, quanto può costare il trattamento..

La leucemia linfocitica cronica è di solito una leucemia "lenta", e questo è fantastico, perché puoi fare una "pausa" e pensare per una settimana. Approfitta di questo! Sentire una diagnosi seria è difficile. Spesso, a causa di un "panico", le persone prendono decisioni che non sembrano giuste..

Voglio offrirti una consultazione assente con il professor Shapiro (specializzato in ematologia), che, sulla base delle analisi e degli estratti che hai a disposizione, elaborerà un piano di esame preliminare. Molto probabilmente, oltre al consueto esame del sangue, sarà richiesto un FISH, una biopsia del midollo osseo, una risonanza magnetica (per determinare i linfonodi interessati). Inoltre sarà possibile esprimere il prezzo esatto (secondo il listino prezzi dell'ospedale Hadassah).

Se la diagnosi è confermata, il professor Shapiro prescriverà un trattamento. Il costo del trattamento può variare notevolmente, a seconda delle raccomandazioni del professor Shapiro, del suo piano di trattamento. Professor Shapiro Uno specialista unico - ha tassi di guarigione molto elevati.

Ciao, per favore dimmi la previsione della Coca quando analizzi BCR -ALB p210 (b3a2) - t (9; 22) 167%
Grazie in anticipo!

Recensioni di trattamento Hll

Ematologo, emostasiologo, sessuologo, medico di famiglia, professore presso il Center for Postgraduate Medical Education, Institute of Medicine and Psychology, Novosibirsk National Research State University, specialista in diagnostica clinica e di laboratorio della patologia della coagulazione del sangue, membro della National Association of Thrombosis and Hemostasis (ISTH), American Association of Hematologists (AHA), Associazione Nazionale Trombosi, Specialisti in Emostasiologia Clinica ed Memorologia, MD, professore, RAE.

Esperienza lavorativa - 16 anni.

Consiglia su:

  • Diagnosi e trattamento dei disturbi della coagulazione del sangue in bambini e adulti (0+).
  • Gestione delle donne in gravidanza con patologia emostatica (trombofilia ereditaria e acquisita).
  • Soluzione congiunta con ginecologi di problemi di aborto spontaneo e infertilità.
  • Selezione di un programma individuale di terapia profilattica per pazienti che assumono farmaci ormonali (GOK, COC o TOS) in presenza di uno stato trombofilo di fondo.
  • Preparazione per la gravidanza per pazienti con disturbi emostatici.
  • Diagnosi e trattamento della sindrome antifosfolipidica.
  • Diagnosi e trattamento della sindrome emorragica.
  • Sviluppo di un programma di trattamento in preparazione alla fecondazione in vitro in pazienti con patologia del sistema di coagulazione del sangue (insieme a ginecologi-riproduttologi).
  • Identificazione e osservazione di pazienti con trombofilia genetica (ereditaria).
  • Diagnosi e trattamento dell'anemia.
  • Consultazioni su sessuologia clinica e sessopatologia.

Recensioni di trattamento Hll

Ciononostante, creo il mio tema.
Non molto tempo fa, alla ricerca di un "miracolo", sono andato a questo forum e mi interessava l'argomento sulla LMC, perché Ho una diagnosi simile per nome - CLL.
Da quell'argomento, ho appreso un trattamento alternativo - MMS. Non ho ancora provato o incontrato una cosa del genere..
Trasferito alcuni messaggi dall'argomento CML, in modo che il significato non venga perso.
Sarò grato a tutti coloro che possono consigliare qualcosa per il trattamento.

Dall'esperienza precedente (prima della chemioterapia) ho provato molte cose: terapia bioenergetica, aconite, Todicamp, ASD, cardyceps e persino metodi diversi, sono persino andati alla setta Ayat. :-)
Le dinamiche positive sono state date da ASD, cardyceps, aconite. Ma i leucociti hanno continuato a crescere e nel 2009 hanno fatto 6 cicli di chemioterapia, dopo di che c'è stata una remissione. La malattia è incurabile al momento, i globuli bianchi sono aumentati nel febbraio 2013, vorrei, almeno, frenare la loro crescita.

Analisi passata il 17/06. Globuli bianchi 54,4, linfociti 74. Comincio a bere da domani MMS.
Ha iniziato a bere da giovedì. La prima goccia è andata bene, anche la seconda. Diluito con acqua, non si è inceppato. Era normale bere, non bere nemmeno e non si è inceppato. Ho ordinato qui - http://mms-club.ru/index.php/2014-01-18-19-01-35. MMS e HCL (attivatore). Una sorta di nuovo attivatore (lo dicono), è più facile bere con esso e non è necessario creare CD.
La diarrea è iniziata al terzo calo, ma ha deciso di aggiungere altro, perché peccato per il cibo. 4 gocce arrivarono con difficoltà. Di sera, la diarrea è peggiorata, per tutta la notte c'è stato questo cattivo sapore in bocca e la nausea mi è venuta in gola.
Al mattino ho ridotto la dose a due gocce..
Ci puoi davvero abituare? Non si può dire che sia completamente brutto, ma.
Ed è necessario aumentare secondo il protocollo 2000 a 12 gocce.
Ho bevuto capsule di estratto di tè verde prima, cancellato, perché è un antiossidante. Ha lasciato le ossa di un'albicocca amara.

Dopo questo messaggio, MikEBB mi ha risposto che non ci dovrebbero essere diarrea o nausea. Altrimenti, non sarò in grado di continuare il trattamento. Solo pensare all'MMS sarà male. È meglio scendere a una dose più bassa e aumentare gradualmente, piuttosto che allontanarsi in modo che non sia possibile continuare il trattamento. Se l'MMS è il trattamento principale, è meglio rimuovere i noccioli di albicocca. Il fatto è che le ossa contengono veleno e l'MMS è progettato per neutralizzare i veleni nel corpo. Si scopre che da un lato neutralizziamo le ossa dell'MMSK e dall'altro spendiamo l'MMS sulle ossa. Un'eccezione può essere solo una medicina senza la quale non si può fare. E puoi anche fare impacchi con MMS e dimexide, quindi MMS penetra nella linfa.

24.06 - Ho anche rimosso le ossa (per la purezza dell'esperimento).
Ho bevuto 3 gocce ieri. Entro la sera sono solo ossessionato da questo odore. Ma la diarrea si è fermata. Oggi ho bevuto le 4 del mattino e mi sono seduto per 10 minuti, tutto mi ha chiesto di tornare indietro.. Ieri ho letto i consigli di Humble, devo provare un po 'di succo invece di acqua.
Sì, è comparso un effetto collaterale: ha perso 1,5 kg (mangio come al solito!). Sogno di perdere 3 kg per un anno, ma qui è impercettibile.

Comincio a bere domani mms.

Grazie breganika Un esperimento molto prezioso! Ricevo la mailing list dell'autore MMS. Scrivono di miracoli! Una cura per l'epatite che non può essere curata da NIENTE! E così via. Organizzano seminari e formazione in corso in tutto il mondo. L'MMS mi ha incuriosito per molto tempo, ho provato a berlo da solo, ma non sono riuscito a causa del gusto, dell'olfatto. Pertanto, mi è piaciuta l'idea di MikEB da bere in una forma diversa. Ma non sono riuscito a ottenere tutto. Penso che questo modulo sia più accettabile..
Successo a te! Tengo i pugni! Segnala a livello regionale come cosa.
Cerca di non arrenderti!
Tutto avrà successo!

Caro, come ho capito, la leucemia linfatica cronica, cioè i processi maligni si verificano nei linfociti maturi, rispetto alla leucemia acuta, in cui il sangue è inondato di cellule blast immature ed è caratterizzato dalla velocità del processo, la tua malattia è più benigna con la possibilità di remissioni a lungo termine.
Mentre studiavo la leucemia molti anni fa, ho letto dei trapianti di midollo osseo e di altri trapianti, che in alcuni casi hanno dato il 100% di cura.
Il nome comune di questo metodo è chiamato fenomeno del trapianto contro la leucemia..
Ti scriverò in un indirizzo e-mail personale di una persona che può darti un po '
consigli per il trattamento omeopatico della leucemia (gratuito).

Piccola domanda, qual è il tuo gruppo sanguigno e rhesus.

Riesci a fare clisteri, alleviano bene la nausea.

E puoi leggere di più, che tipo di clistere?

L'herpes salta a giorni alterni in luoghi diversi dove non era mai apparso prima, solo sul labbro, sul viso.

Reazione di herpes di esacerbazione di piaghe con una forte alcalinizzazione di MMS.. Ho avuto qualcosa di simile. Penso che questo sia un processo normale..
Raggiungi almeno fino a sabato!

Tutti ragazzi! Sono sull'orlo.
Malato di un tipo di bolla. Il numero di gocce è nuovamente diminuito, è iniziata la diarrea. In breve, meno che piacevole che spiacevole. Sono venute fuori le emorroidi. L'herpes salta a giorni alterni in luoghi diversi dove non era mai apparso prima, solo sul labbro, sul viso.
Anche il numero di ricevimenti è ridotto, accetto come passa più o meno la nausea.
Fino a sabato ho potuto resistere, passare l'analisi.

Alcune persone non possono assumere droghe secondo schemi standard, ma capisco che stai cercando di guidare te stesso negli standard, intendo il numero di cadute, la frequenza di somministrazione, ecc. Ho esperienza con MMS e CDS e ho persino raggiunto dosi che superano le raccomandazioni, ma ho fatto tutto questo P-O-S-T-E-P-E-N-N-O. So in prima persona quanto sia spiacevole l'MMS dopo un sovradosaggio, e come solo pensarci mi faccia rabbrividire, e ti ho avvertito di questo nei miei post. Ora hai la tua esperienza :-). Cosa farei ulteriormente nella tua situazione. Se hai tempo, rimanda la ricezione di MMS per un paio di settimane, ma prometti a te stesso che tornerai su di esso. Bevi un corso con vitamina C in questo momento, un sacco di succhi freschi e cibi vivi, rilassati. Quindi trova il tuo MMS e prenditi il ​​tuo tempo, inizia con mezza goccia su mezzo bicchiere di composta di mele senza zucchero, inizia a prendere 1 - 2 volte al giorno, ma solo per farti sentire a tuo agio. Rimani mezza goccia per diversi giorni e quando sei convinto che questa tecnica non ti causi alcun disagio, salta alla goccia, quindi se sei sicuro dopo 2 o 3 giorni che tutto è in ordine e una goccia non ti causa problemi --- muoviti anche lentamente più lontano. Se almeno un po 'a un certo punto ti senti a disagio, fai un passo e / o due all'indietro, rafforza la tua posizione e vai avanti alla dose terapeutica.
Ti auguro prudenza e vittoria sulla malattia.

Alcune persone non possono assumere droghe secondo schemi standard, ma capisco che stai cercando di guidare te stesso negli standard, intendo il numero di cadute, la frequenza di somministrazione, ecc. Ho esperienza con MMS e CDS e ho persino raggiunto dosi che superano le raccomandazioni, ma ho fatto tutto questo P-O-S-T-E-P-E-N-N-O. So in prima persona quanto sia spiacevole l'MMS dopo un sovradosaggio, e come solo pensarci mi faccia rabbrividire, e ti ho avvertito di questo nei miei post. Ora hai la tua esperienza :-). Cosa farei ulteriormente nella tua situazione. Se hai tempo, rimanda la ricezione di MMS per un paio di settimane, ma prometti a te stesso che tornerai su di esso. Bevi un corso con vitamina C in questo momento, un sacco di succhi freschi e cibi vivi, rilassati. Quindi trova il tuo MMS e prenditi il ​​tuo tempo, inizia con mezza goccia su mezzo bicchiere di composta di mele senza zucchero, inizia a prendere 1 - 2 volte al giorno, ma solo per farti sentire a tuo agio. Rimani mezza goccia per diversi giorni e quando sei convinto che questa tecnica non ti causi alcun disagio, salta alla goccia, quindi se sei sicuro dopo 2 o 3 giorni che tutto è in ordine e una goccia non ti causa problemi --- muoviti anche lentamente più lontano. Se almeno un po 'a un certo punto ti senti a disagio, fai un passo e / o due all'indietro, rafforza la tua posizione e vai avanti alla dose terapeutica.
Ti auguro prudenza e vittoria sulla malattia.


Oh grazie mille! Ti sono così grato!
Sì, perché ti ho letto, ma sembra che ho dovuto sviluppare la mia esperienza.
Dopotutto, ho deciso di farlo: è diventato male, ho ridotto la dose e il numero di dosi. Li ho ridotti a tre al giorno, ma a volte ne faccio due. Se agita prima di una dose, salta. Analizzerò domani.

breganika,
Con tutto il cuore ti auguro buone prove e il meglio.

Il risultato è globuli bianchi 40 (15,4 in meno rispetto all'analisi precedente), 72 linfociti (c'erano 74).
Un piccolo confronto non è corretto, perché l'ultima volta che non c'era nessun assistente di laboratorio, ha fatto la macchina.
MMS categoricamente, finora, non rifiuto. Dobbiamo guardare oltre nella dinamica. Il mio assistente di laboratorio ha smesso, ma questo, apparentemente, non male, ha persino mostrato al mio microscopio i miei linfociti. : D

Nessun valore di riferimento. Buono o cattivo, come valuti? Era meglio prima o dopo?

Ho un aumento regolare dei globuli bianchi e dei linfociti. L'ultima analisi è stata il 17/06/17. Rispetto a lui, i globuli bianchi sono diminuiti di 14,4 unità. Nella mia malattia, ogni dieci gioca un ruolo, quindi se il precedente è stato fatto bene, allora c'è un miglioramento.

Quindi, varrebbe la pena continuare, solo per migliorare il metodo, come consiglia MikEB..

Quindi scrivo che dobbiamo guardare oltre. Se c'è un calo in un paio di settimane, allora sicuramente funziona.

Ti sfido. Alleni la tua immunità))). Ho trovato alcuni siti utili con trattamenti alternativi. Esiste un sito con una cura confermata completa, ce ne sono diversi con una significativa riduzione dei globuli bianchi. Se possibile, ti darò dei link.
Su di me. 55 anni CLL da ottobre 2013. Secondo vecchi test (mi mancava un medico dal 2011 (forse dal 2009, se consideriamo significativi i linfociti 4,9).

Arin, ti sarò solo grato!
Non avevo mai incontrato prima che qualcuno fosse guarito, sembra che vada nei siti sbagliati. - (
Sperimentando a tuo rischio e pericolo, hai ragione.
E tu stesso provi qualcosa dall'alternativa o dalla gente?
A proposito, abbiamo la stessa età!

Non so se sia possibile fornire collegamenti ad altre risorse (forum stranieri). Se possibile, fornirò un link in cui la persona è stata curata da CLL. È vero, aveva 28 anni. E posso dare un link a un australiano che ha abbassato i globuli bianchi da 77 a 3.
Ho grandi progetti: ho raccolto molte informazioni dagli stranieri. Tuttavia, hanno tali pazienti: 160.000. E in Russia, circa 15.000. Non so come stai in Kazakistan. Anche se io, se ti ho identificato correttamente, ricordo che sei una donna russa

Secondo me, puoi dare dei link. Ho visto che danno. Siamo tutti alla ricerca di trattamenti qui..
Nel peggiore dei casi, in PM puoi sicuramente scrivere.
In qualche modo mi ci sono abituato, non lo considero nemmeno un trattamento, invano, probabilmente.
Lo uso da molto tempo. Mangio polline (compro e mescolo con miele). Bevo solo tè verde, a volte bevo cicoria anziché caffè. Inoltre, estratto di tè in capsule (non ricordo il dosaggio, un barattolo a casa). Ho visto una capsula, ora due.
Sì, gli stranieri hanno di più con CLL. Sono una donna russa, non ti sbagli.
Vivo in Kazakistan da 9 anni. I kazaki ottengono molto raramente CLL e LMC. Hanno spesso emoglobina bassa o leucemia acuta. Questo è tutto ciò che penso - forse mangiano in modo tale da non ammalarsi di nostro?
A volte ricordo il mio dolore, mi sentirò un po 'triste, ovviamente, ma devi vivere!
Dopo la chimica sono andato a ballare e questo rinvigorisce così tanto! L'umore è in aumento!
E ad agosto, la figlia fa un regalo: il nipote nascerà! Il primo!
La vita va a vanti!

Quindi do i collegamenti a tutto ciò che è utile che ho scavato

Qui un po 'poco chiaro, molti collegamenti a dove sta comprando. Il risultato è di breve durata. Ma vale la pena leggere

Ecco, a mio avviso, il più interessante

Ora ho superato l'analisi per metalli e altre tossine (dai capelli). Riceverò una risposta, gli scriverò

È solo curioso qui. Ma, a quanto ho capito, non ci sono risultati speciali.

Questo blog parla di nuovi farmaci. Riguarda la medicina ufficiale, ma mi calma un po '. Scrive un medico, un canadese nato dagli Stati Uniti. Spostato TKM (è ebreo ashkenazita di nazionalità)

Ecco il forum di supporto CLL
http://translate.google.com/translate?hl=en&sl=en&u=http://www.dailystrength.org/c/Chronic-Lymphocytic-Leukemia-CLL/forum&prev=/search%3Fq%3Dforum%2Bcll%26newwindow % 3D1% 26sa% 3DX% 26hl% 3Dru% 26biw% 3D1275% 26bih% 3D582
Molte alternative utili, come calcio e D3. Ma non vado nei siti che raccomandano, non voglio un aspetto negativo
http://translate.google.com/translate?hl=en&sl=en&u=http://www.dailystrength.org/c/Chronic-Lymphocytic-Leukemia-CLL/forum&prev=/search%3Fq%3Dforum%2Bcll%26newwindow % 3D1% 26sa% 3DX% 26hl% 3Dru% 26biw% 3D1275% 26bih% 3D582

Anche la ricerca di Karl June mi sta portando alla normalità. Ci sono CI. E anche una remissione ideale)) Ma nella nostra malattia finora solo il 50%. Ma funzionano.
Congratulazioni per tua nipote. Le mie ragazze non partoriscono ancora)))

+assunzione di soda (metodo del Dr. Young, aumento del pH, ho adenocarcinoma endometriale).

Qual è il tuo ph? Come misurare?

Quindi do i collegamenti a tutto ciò che è utile che ho scavato


Molto interessante da leggere!
A proposito, in qualche modo mi sono imbattuto in un articolo in cui un paziente con CLL è stato curato dalla dieta di Dio (Alleluia). Soprattutto poi ho cercato che tipo di dieta.
Ma. Interessante. Un australiano che ha ridotto i globuli bianchi non ha seguito una dieta vegetariana.
All'inizio, ovviamente, sono salita ai siti di guarigione.

Per quanto ho capito, la leucemia non dovrebbe seguire una dieta vegetariana. Sembra che siano necessari il 70-80% di verdure e simili e un po 'di carne e proteine.
Sto provando a bere l'estratto di tè verde ora (ne ho scritto). Ma quando ho iniziato a bere il tè da gennaio, il mio AST e ALT sono aumentati - 2 volte la norma. Quindi sono tornati alla normalità. Devi scegliere ciò che è più importante in questo caso, i leucociti o gli indicatori del fegato. Quindi seguirò un corso di quercetina (grano saraceno in capsule))). Inizierò il 20 luglio. Dopo i risultati dell'analisi delle tossine, proverò a chiedere l'elenco completo dei test che l'australiano ha svolto. E prova a cercare un erborista. Controllo la formula dei leucociti ogni 7-10 giorni. Tutto va in giro

Sì, ho letto che abbiamo sicuramente bisogno di proteine. Consigliamo la carne di cavallo qui, è considerata la carne più pulita. Quando ero a dieta con grano saraceno, mi hanno anche detto: perché non provare le capsule di quercetina. La concentrazione è maggiore. Voglio ripetere la dieta del grano saraceno, ma dopo la fine della stagione della frutta.
Scegli una posizione erborista. Sono andato a uno. Onestamente, l'avena ha bevuto in un mese - 10 cavalli sarebbero sufficienti. :-)
Quando sono arrivato, ho iniziato con quello. ma Raisa Gorbacheva è morta e tu cammini ancora. Così disgustoso. Inoltre, aveva una completamente diversa.
Volevo chiedere: dove ha fatto l'analisi dei capelli, ho letto nei link a riguardo, ma come lo chiamiamo e dove farlo.

La dieta del grano saraceno è troppo restrittiva in frutta e verdura..
L'analisi è stata effettuata in INVITRO. Ne hai uno in Kazakistan? Se c'è, dirò il numero. Ma non conosco ancora i risultati, quindi non posso raccomandarlo. Ma ho un sigillo-8 e un tutto-amalgama. E altri 3 ponti.


Sì, risulta INVITRO.
Bastone e ponti sono anche sufficienti! Sì, e sotto le corone, queste otturazioni.

Con l'acidità, non riesco davvero nemmeno a raggiungere le 7 di sera e non più di 6 di mattina. Ho letto consigli sulla soda.

Non riesco a trovare la cartina di tornasole da nessuna parte (forse sto guardando male).
Ho letto i tuoi link, ma non tutti, però. grazie ancora!
Sono giunto alla conclusione che dobbiamo aumentare la quantità di tè verde. Aggiungi la vitamina D (non l'ho bevuta affatto) e la vitamina C..
Ora finirò l'esperimento con MMS, perché La vitamina C non è raccomandata lì e la diffusione nel tempo è scomoda.

Ho cercato informazioni oggi tramite MMS, mi sono imbattuto in un sito Web: www.salinomycin.ru


Il sito è strano, non si apre fino alla fine.. Hai provato ad andare in profondità ?? Aperto?
C'è una discussione sull'argomento del farmaco Salinomicina, che questa azienda utilizza. da un altro forum.
http://rak.flyboard.ru/topic988.html

Il sito è strano, non si apre fino alla fine.. Hai provato ad andare in profondità ?? Aperto?
C'è una discussione sull'argomento del farmaco Salinomicina, che questa azienda utilizza. da un altro forum.
http://rak.flyboard.ru/topic988.html

Sembra aprirsi con me, lì è scritto sulla droga stessa. Vago, che aiuta con tutti i tipi, ecc..
Generalmente notato, per noi, poco è efficace.

Sono riuscito a ordinare cartine di tornasole su Internet. Non ho trovato neanche in farmacia.


Indirizzo non salvato? Sarò in Russia ad agosto, ordinerò una figlia se non spediscono in Kazakistan.
A proposito di tè - cosa succede se bevi carlsil per il fegato? In chimica, ci hanno detto di berlo.

Ho comprato le strisce reattive qui

Stavo pensando alle macchine e qualcosa del genere. Ripeterò AST e ALT il 1 ° agosto e poi deciderò di prendere il caril.
In genere sono in perdita, è difficile e insolito per me essere trattato. L'ultima volta che mi sono ammalato nel 2005 è stata la colecistite. Il mio naso che cola dura 2-3 giorni, non di più. E poi ha ceduto alla chiamata per sottoporsi a un esame fisico e ha ricevuto una diagnosi. Pertanto, non immagino ancora come trattare, ho studiato solo la diagnosi che mi è stata espressa. Bene, ho cercato metodi di trattamento.
Lo spero davvero per questo
http://remedium.ru/news/detail.php?ID=62462)))))

Qui ho studiato come è stato trattato il mio collega disgraziato dall'Australia. L'approccio è interessante, sistemico. Si chiama terapia radicale libera. Studiamo la biochimica del corpo, cerchiamo punti deboli, deviazioni, sul mantenimento dell'immunità che spende le sue forze principali. Quindi queste debolezze, deviazioni dalla norma, vengono trattate. In questo caso, è necessario inizialmente superare un esame del sangue almeno 48! indicatori. Suppongo che nessun singolo medico con noi, e ancora di più con te, sia in grado di analizzare un tale numero di indicatori. E per curare, sì, metodi alternativi.
In generale, dobbiamo lentamente cercare modi per curarci.

Quest'anno, in compagne di classe, ho incontrato tre donne con CLL. Due vivono in Ucraina. Uno di loro ha rilasciato un permesso di soggiorno in Russia e lì ha seguito un corso di chimica (fludara e ciclofosfamide), ora in remissione. La seconda aveva i globuli bianchi circa 30 due mesi fa, ora non può arrivare a Donetsk per fare i test a causa dei bombardamenti. Beve soda, niente di più. Il terzo vive a Mosca ed è attualmente sottoposto a trattamento sperimentale presso la clinica Blokhin. A Tomsk mi dissero di prendermi del tempo, perché non avevo fretta di curarmi, perché nell'approccio ci sono tre farmaci nelle ultime fasi del test, che hanno grandi speranze che il CLL sia curabile.
Qui tiro. Non sono in ospedale già da 3 mesi, perché il mio grida che mi sono già adagiato sulla chimica. Ha iniziato a urlare non appena i globuli bianchi sono usciti dalla norma ed erano 10.3. Non riesce a parlare con calma, ma non voglio sprecare i nervi.
Grazie per l'indirizzo!
Ma l'MMS è molto difficile da bere..

E su quali droghe ti hanno detto?
Soda la aiuta?

I farmaci non sono stati nominati. Una donna che non conosce il nome nel trattamento sperimentale o non lo dice.
Colui che beve soda afferma che i globuli bianchi inizialmente sono diminuiti di circa 10 unità e sono rimasti in piedi 4 mesi. Almeno non aumentato. Ma ora, per molto tempo, non ho superato l'analisi.
Ho una risposta (riguardo alla salinomicina), chiedendo un estratto.
Proverò a inviare quello che ho. La dichiarazione non mi verrà data semplicemente.

Ho una risposta (riguardo alla salinomicina), chiedendo un estratto.

Quale affermazione. E se una persona non vive in Russia, allora potrebbe non esserci alcuna dichiarazione. Penso che sia necessario descrivere loro la diagnosi, i risultati dell'analisi.. e chiedere se possono aiutare. Quanto costa e così via.

Quale affermazione. E se una persona non vive in Russia, allora potrebbe non esserci alcuna dichiarazione. Penso che sia necessario descrivere loro la diagnosi, i risultati dell'analisi.. e chiedere se possono aiutare. Quanto costa e così via.

Così ho fatto - ho inviato i risultati di tutte le analisi (OAC, biochimica, citologia, ecc.). Domande su costi, consegna. Aspettando una risposta.

Così ho fatto - ho inviato i risultati di tutte le analisi (OAC, biochimica, citologia, ecc.). Domande su costi, consegna. Aspettando una risposta.

Nessuno mi risponde.
Ieri sono stato contento che l'MMS stesse bevendo normalmente, e oggi di nuovo mi fa male, anche lo stomaco si schiaccia in quel modo. Dobbiamo riposarci di nuovo da lui.

E quando farai un'analisi di controllo?

Ieri l'ho pensato tra una settimana e oggi ho deciso di passarlo sabato per controllare l'MMS.

Annulla l'iscrizione quindi c'è il risultato di tale sofferenza)))

Bene, annulla l'iscrizione.
Il risultato non mi è piaciuto per niente. Come con CML, questo non sembra funzionare..
Globuli bianchi 60.2 (+20.2)
Linfociti 82 (= 10).

Butta via, ovviamente, non farò MMS (non lo saprai mai.). A proposito, se qualcuno viene dal Kazakistan, posso dare gratuitamente un test. Oppure, volando a Tomsk via Novosibirsk in agosto, chi vorrà provare, lo porterò con me.

Ora deciderò per una settimana cosa testare ulteriormente e in battaglia!

breganika, hai scritto: "ASD, cardyceps, aconite hanno dato dinamiche positive".
Potrebbe essere invano abbandonato?
Prova la cicuta, come consiglia MikEB..

A Tomsk, vai al centro di oncologia?

breganika, hai scritto: "ASD, cardyceps, aconite hanno dato dinamiche positive".
Potrebbe essere invano abbandonato?
Prova la cicuta, come consiglia MikEB..

A Tomsk, vai al centro di oncologia?

Come mi consiglia MikEB, temo. Ci proverei sotto la supervisione, e così.
Mi sto sporgendo verso ASD ora. Inizierò a bere tra una settimana.
Vado a Tomsk o no, non lo so. Se il dottore non va in vacanza, allora andrò sicuramente.

breganika, prova ad entrare, buone recensioni su di lui.

IMHO, non puoi lanciare veleni.

Esistono molti modi per preparare i composti dalla cicuta, nonché i metodi per la sua applicazione. Ogni guaritore si attacca al proprio. Ci sono, ovviamente, e modi comuni inclusi in molti libri..
I metodi suggeriscono di lavorare sia con erba secca che con erba fresca. L'uso più comune di erba secca.
La ricetta di base per la tintura su erba secca 10 g di erba per 100 ml di vodka (in alcuni casi, si consiglia l'alcool), insistere per una settimana in un luogo buio, quindi filtrare.
Questa tintura si chiama 10%.
Questa tintura viene utilizzata nel metodo di Tishchenko Yu.V..
Vengono prese da una a venti gocce al giorno di tintura di cicuta. In media: due gocce per cucchiaino di acqua cinque volte al giorno, un corso di dieci giorni, una pausa di 2 mesi.
La stessa tintura viene utilizzata nella tecnica chiamata "Royal":
La tecnica più popolare, ma non sicura, è la tecnica di ciclismo "reale". Nella Bibbia, il salmista David si lamenta con Dio: "Con tutte le tue onde mi hai colpito". Fu con questo metodo che decisi di schiacciare la testa del dannato nemico.

Al mattino a stomaco vuoto, un'ora prima dei pasti, somministrare mezzo bicchiere d'acqua una goccia dell'infusione. Domani, allo stesso tempo, ci saranno già due gocce - e quindi, aumentando quotidianamente la dose di una goccia al giorno, si esce a 40 gocce, dopodiché, diminuendo gradualmente una goccia ogni giorno, torniamo di nuovo a una. E quindi è necessario ripetere più volte fino a quando il tumore scompare completamente. Allo stesso tempo, il corpo sta acquisendo un potenziale immunitario sufficiente per monitorare in modo indipendente la situazione in futuro.

Questa è una tecnica efficace e ci sono casi in cui le persone completamente senza speranza si sono sbarazzate del cancro - il cancro al seno, il cancro esofageo, il cancro allo stomaco, il cancro al fegato e in generale il CANCRO, sono soppressi da una cicuta con questo metodo. Ma l'esperienza con i pazienti suggerisce che non tutti possono fare queste dosi e talvolta le esacerbazioni iniziano dopo 25 gocce, e quindi il mio consiglio su questa tecnica è che è meglio non testare il destino e che i pazienti indeboliti non dovrebbero superare le 25 gocce. Naturalmente, questi dosaggi sono validi per la concentrazione ottenuta durante la preparazione della tintura nelle proporzioni sopra descritte.

Se, all'inizio del trattamento, abbiamo un sistema immunitario completamente piantato e, essendo condannato, avevamo solo la tintura a portata di mano, ponendo le nostre deboli speranze su di esso, quindi, a partire dal secondo ciclo, abbiamo notevoli spostamenti positivi verso il recupero - un sistema immunitario decente potenziale (hemlock migliora qualitativamente il sistema immunitario) e ancora la stessa tintura di hemlock. Ma la cosa più importante che abbiamo guadagnato in questo momento è la fiducia nella droga scelta e il buon umore. Ed è verificato in pratica.

Tuttavia, la mia tecnica più comune, la più sicura ed efficace, è di 15 gocce, dove gradualmente, come nel primo caso, aumentando a questa dose, manteniamo questo numero di gocce e proseguiamo fino al completo recupero.

Con i tumori inoperabili e gli ultimi stadi, viene utilizzato lo schema Nikiforov Yu.V.: Inizia con cinque gocce, quindi aggiungi una ogni giorno. Porta il numero di gocce a trenta. Successivamente, iniziamo a diminuire. Riduciamo anche da uno a cinque. Pausa per cinque giorni e ripeti nuovamente il corso. Quindi tre corsi. Accoglienza tre volte al giorno. Diluire le gocce in acqua - 50 ml.
Applicare lo stesso succo di foglie. Anche in proporzione di due gocce per cucchiaio di acqua.

Sfortunatamente, non posso fornire un link alla fonte, l'ho copiato da solo, qui sul forum.

Recensioni di trattamento Hll

potresti chiarire un po 'di te: quando la malattia ha iniziato a svilupparsi, quanto dura, qual è la tua condizione fisica, come sei trattata, qual è il tuo umore, cosa stai facendo, quanto hai familiarità con le caratteristiche di questo problema? Ti è stata data la chemioterapia e hai pulito il tuo corpo da allora?

La diagnosi è stata fatta quest'anno, il trattamento con il farmaco Gleevec, all'inizio del ricevimento è stato molto male, ora è normale, ma non sono autorizzati a lavorare, ma non c'è x / t

Comunque sia, dovresti iniziare a combattere questo problema da solo

il suo ulteriore sviluppo avviene in modo diverso per sempre in modi diversi. È positivo che siamo riusciti a catturarlo nella fase iniziale. Con il comportamento giusto, l'ulteriore sviluppo non solo può essere rallentato, ma anche fermato. Spero tu lo sappia. Pertanto, è necessario utilizzare gli stessi metodi utilizzati dai pazienti in altre forme. Per iniziare, guarda questo argomento http://ykt.ru/cgi-bin/forum/iforum.isa?f=24&a=rx&id=238023 scrivi, se ritieni necessario, alla spada o e-mail. ti auguro una veloce guarigione!

Ho un buon amico con una diagnosi simile. Galina. Vive in Kazakistan. Quando l'ho informata del tuo problema, mi ha risposto: ------------------ Boris, ovviamente, dai il mio indirizzo a questa ragazza con CML, posso aiutare con cosa, e lei può Dimmi qualcosa. Dopotutto, ci sono pochi casi con sangue. A proposito, si prevede che la sua malattia sia migliore della mia - CLL, più facile da curare, in modo da poterla calmare. Ha molti monociti, io ho i linfociti. Sì, ti ho scritto sulla nutrizione, perché mercoledì ho fatto il giorno della fame, ma mi sono fermato, ho trovato molta letteratura che con la leucemia, i nutrienti provengono dal sangue, in questo caso, durante la fame, le cellule malate li prendono per primi, perché sono più attivi e le persone sane stanno morendo di fame e non possono adempiere alla loro funzione, hanno rifiutato la fame, ma hanno aumentato la quantità di cibo "vivo" - frutta, verdura, senza carne. La quantità di emoglobina è salita a 149. I leucociti stanno ancora crescendo un po ', ma non ci sono linfociti. (Ricorda, a Tomsk un guaritore mi ha detto che ha interrotto il processo, è davvero così?). Posso consigliarle le tasse che mi sono appena state assegnate, sono tutte per la formazione del sangue, tranne per questo, ho bisogno di pulire costantemente il mio sangue (le raccomandazioni di Tishchenko) - origano, brodo di pino + buccia di cipolla + liquirizia + cinorrodo, fiori di castagno. Alternare questi decotti dopo 3 giorni. La sciabola (tintura di alcol) aiuta bene. Bere un cucchiaino 3 volte al giorno (non raffreddare troppo) - L'ho provato su me stesso. Un'altra tintura di alcol delle bucce di noci di cedro - anche 3 cucchiaini. in un giorno. ------------------ Quindi, se hai il desiderio di corrispondere, ti dirò l'indirizzo di Galina.

Ciclo di oncohematology. Parte 1. Leucemia linfocitica cronica.

Ciao a tutti :) Leggendo Picabu, ho notato che molti utenti sono attivamente interessati all'argomento dell'oncologia, giusto? E ho deciso di provare a scrivere un ciclo relativamente piccolo. Dato che preferisco di più l'argomento di Oncohematology, scriverò su di esso (che sto ingannando - riscriverò semplicemente vari estratti di libri intelligenti in una forma accessibile a un semplice uomo medio).

Sto scrivendo un classico, senza troppa scienza. Alcuni dati potrebbero essere integrati o addirittura confutati (NON DEVE?!)

Perché la leucemia linfatica cronica (CLL) viene prima di tutto?

Questo è il tipo più comune di emmoblastosi (cancro del sangue, quindi GB), le statistiche ti diranno che quasi il 30% di tutti i GB sono CLL. Se vivi nello spazio post-sovietico, circa 5-7 persone si ammaleranno ogni 100000 abitanti della tua città / città / acquario in un anno. Tuttavia, non affrettarti a iniziare a contare le probabilità così rapidamente. L'età media di insorgenza di CLL è di circa 65 anni, incl. non tutti vivrete fino a tanti anni: D

Quindi qual è il punto? Quali sono le cause CLL??

Ci sono molte teorie - se in poche parole (quasi):

Siamo costituiti da cellule e in quali cellule, se non nelle cellule del midollo osseo, sono cromosomi?

Sì, la questione è nei cromosomi. In questi cromosomi si distinguono sezioni speciali, le spalle lunghe e corte sono importanti per noi adesso.

Su tutte queste spalle, ancora una volta, si distinguono gli speciali. sezioni, ognuna delle quali è responsabile di un certo gene, proteina, per qualcos'altro - queste sezioni della scienza sono di solito semplicemente numerate. Qui aggiungiamo la conoscenza che le mutazioni si verificano costantemente nel corpo (che, fortunatamente vengono corrette o distrutte, questo è normale, stiamo prendendo in considerazione la patologia) e già con l'accumulo di un GRANDE numero di mutazioni in determinate aree, sorgerà il solo clone doloroso precursore dei linfociti. Questo clone inizia a moltiplicarsi, a svilupparsi in uno stato più o meno maturo (da questo, a proposito, la parola "Cronica" nel nome, e non dal fatto che questa è una malattia in una persona per lungo tempo, la leucemia linfatica acuta può anche essere per molto tempo, ma le cellule in questo caso giovani e sottosviluppati) e in crescita, catturando sempre più aree del midollo osseo, dopo di che entrano nel sangue circolante e colpiscono altri organi e tessuti (almeno questa teoria è considerata la principale al momento).

Prendi una persona teorica che ha già il 100% di questo disturbo.

Cosa accadrà per gradi ?

Si possono distinguere diverse fasi della malattia..

Stadio 0: non si manifesta esternamente, ma con un esame del sangue eseguito casualmente puoi già vedere un aumento del livello di linfociti (il numero assoluto di LINFOCITI (non globuli bianchi in generale, vale a dire singoli linfociti) su un bicchiere è maggiore di 5,0x10 ^ 9). Le previsioni in questa fase sono buone - più di 10 anni.

Fase 1: è possibile notare un aumento dei linfonodi (> 1 cm) in tutto il corpo, un cambiamento nella forma dei linfonodi da ovali a tondi, la densificazione, i linfonodi possono essere dei cluster, un segno distintivo della maggior parte delle infezioni (tranne che cronicamente circolanti): sono indolori. Spesso c'è un aumento della temperatura, debolezza, infezioni frequenti. Le previsioni sono ancora abbastanza buone per 7-10 anni.

Fase 2 - La milza aumenta notevolmente (spesso insieme al fegato) + 1 fase. Previsioni per 5-7 anni.

Fase 3 - Vi è una debolezza, che è spiegata da una grande diminuzione dell'emoglobina (

Quale diagnosi speciale ?

Puntura del midollo osseo con una valutazione della qualità e del numero di cellule, un esame del sangue generale, studi sul DNA (PCR), studi immunoistochimici, citometria a flusso. La ricerca, se interessata, dovrà cercare su Google, perché qui ogni studio merita un post separato, se non uno.

Tutto è blu - i linfociti desiderati, ce ne sono troppi.

Trattamento? (Non vedo il punto di descrivere gli schemi e le proprietà dei singoli farmaci, perché lo dimentichi comunque)

Ora usato: chemioterapia + anticorpi monoclonali per l'etichetta (CD20 - il nome di questa etichetta) di linfociti, il più delle volte è RituxiMAB / MabThera e altri anticorpi che terminano in -MAB) + se possibile, il trapianto di midollo osseo è eccellente (gli studi dicono che questo è estremamente in modo efficiente).

In generale, la malattia procede stabilmente, ad eccezione dei casi di malignità ancora maggiore nella sindrome di Richter e della trasformazione della leucemia linfocitica cronica in leucemia linfocitaria acuta (il nome di questa trasformazione è crisi di scoppio).

So che ho omesso molto, scritto molto semplificato e ancora ho cercato di trasmettere le informazioni di base per un semplice profano.

In ogni caso - commenta, indica difetti, colpisci con le pantofole per l'ortografia e la punteggiatura, indica imprecisioni nel materiale - impareremo insieme nuove cose.

Grazie per aver letto :)

Nessun duplicato trovato

Hey. Quindi posso avere hll? I linfociti crescono ogni anno e cadono i neutrofili. Linfociti in% 65 al tasso di 40 e neutrofili al 28%. Gli arochai non prendono misure (

Dove altro posso lanciare una quercia? Non cade.

Ciao, buttiamo via la quercia che ho consegnato fresco al dottore un mese fa, ma lunedì lo darò a me stesso. Non decollare, scrivono una piccola valutazione (.

Nel primo stadio, l'aumento non è nel numero assoluto di linfociti, ma nel relativo, cioè come percentuale del numero totale di leucociti. Sfortunatamente, non ha quasi alcun valore diagnostico, perché aumento dei linfociti nei leucoformoli (oltre il 37% negli adulti) può avere ragioni molto diverse.

Notizie n. 1011: i biologi norvegesi imparano come determinare la prontezza del pollo

Notizie n. 1010: il lievito di Baker ha insegnato a produrre psilocibina

Come muta il coronavirus e quanto è grave? Guardiamo esempi reali

Sono giunti tempi noiosi per coloro che leggono libri di fantascienza degli anni '70 sulle discipline tecniche durante l'infanzia: il bosone di Higgs o le caratteristiche dell'orizzonte degli eventi di un buco nero rotante carico potrebbero essere lette mezzo secolo fa. Oggi la biologia è un'area in cui è difficile seguire i progressi. E se la racchetta è piena di materiali sulle discipline tecniche, che è tradizionale per la Russia, la biologia e la bioinformatica sono estremamente scarsamente rappresentate.

Negli ultimi 18 anni, il costo del sequenziamento del genoma umano è sceso centomila volte a $ 1.000. La lunghezza del genoma umano è di tre miliardi di nucleotidi e il genoma del coronavirus SARS-CoV-2 è costituito da soli 30 mila nucleotidi. Data la convenienza e la rilevanza, molti genomi del coronavirus sono già stati sequenziati e resi disponibili al pubblico.

Il genoma del coronavirus è così corto che può essere aperto come file di testo in un taccuino e le differenze nella sequenza nucleotidica di due diversi genomi sono visibili ad occhio nudo.

Puoi scaricare genomi con un solo pulsante in GenBank, c'è anche un genoma iniziale di riferimento da dicembre 2019 del cinese Wuhan. Il genoma è una sequenza di soli quattro tipi di nucleotidi: A / G / T / C, ovvero adenina, guanina, timina, citosina. Di conseguenza, oltre alla narrativa minima e un mucchio di lettere A / G / T / C, non c'è nulla lì. Forse questo è uno di quei rari casi in cui la raccolta dei dati per l'analisi richiede meno tempo dell'analisi stessa.

I genomi del coronavirus. A sinistra è il genoma "iniziale" del cinese Wuhan dal 2019, a destra del 24 marzo 2020, prelevato da uno di quelli infetti negli Stati Uniti. L'inizio del primo gene nel genoma è evidenziato in blu. Per facilità di visualizzazione, la sequenza è divisa in colonne della stessa larghezza.

Fortunatamente, è già stata costruita una mappa del genoma e sono note le sequenze nucleotidiche di tutti i geni del coronavirus. Ad esempio, il primo gene codifica per la proteina orf1a, i suoi primi 21 nucleotidi sono: ATGGAGAGCCTTGTCCCTGGT - appena trovato ed evidenziato nello screenshot. Conoscendo le parti iniziali e finali dei geni, per non parlare di tutti i geni, è facile marcare il genoma e capire cosa è cosa in questa istanza di coronavirus.

Alcune parti del genoma non sono incluse in nessun gene: si tratta di DNA spazzatura (RNA), che non trasporta informazioni ereditarie e può mutare (cambiare) a proprio piacimento senza danno e beneficio per il virus. Il DNA spazzatura formava gli spazi tra i geni, così come l'inizio e la fine del genoma. Nella foto sopra, le prime righe sono solo DNA spazzatura e, ad esempio, la prima riga non corrisponde.

Poiché il genoma in tutte le sue parti è essenzialmente lo stesso insieme di lettere A / G / T / C, per semplicità di analisi, puoi concentrarti sulla parte del genoma - su qualsiasi gene.

Per la penetrazione del virus nella cellula sono proteine ​​responsabili (s-proteina), che sembrano un picco sulla superficie, formando insieme la “corona” che ha dato il nome a questo tipo di virus. Sono queste proteine ​​che i vaccini in fase di creazione mirano a fermare la diffusione dell'epidemia..

Se la proteina S muta rapidamente e con forza, i vaccini non terranno il passo con nuove mutazioni, come nel caso dell'influenza stagionale.Se lentamente, un vaccino salverà l'umanità dai problemi per lungo tempo.

Considereremo le mutazioni del gene responsabile della codifica della proteina s.

Illustrazione schematica di un coronavirus. La proteina S è marcata in alto a destra

Dalle parole ai nucleotidi

L'intero genoma del coronavirus è di circa 30.000 "lettere". La sequenza nucleotidica del gene S-proteina è nota, ci sono 3822 in totale. Ad esempio, i primi cinquanta:

Ecco gli ultimi cinquanta:

Se, come Michelangelo, in ogni genoma taglia tutto prima di queste prime cinquanta lettere e dopo le ultime cinquanta, allora il gene s-proteina rimane. Posizionando ciascun gene in una stringa di Excel, è conveniente notare le mutazioni. Ad esempio, nello screenshot seguente, alcune persone infette da Hong Kong nella 22a posizione hanno G invece della solita T:

Uno screenshot con dati generali sul genoma e la parte iniziale del gene S-proteina. Le frecce indicano mutazioni (sostituzioni) T -> G

Un genoma o un singolo gene sono semplicemente informazioni ereditarie. Secondo queste informazioni, ciò che funzionerà in futuro è la proteina (1 gene -> 1 proteina). Una mutazione in un gene è di solito, nel nostro caso, una sostituzione di una "lettera" con un'altra. Alcune mutazioni nel gene portano a un cambiamento nella proteina, altre no. Alcuni cambiano la proteina debolmente, altri fortemente, il che probabilmente porterà alla disabilità del virus, poiché la proteina prodotta dal gene altamente mutato sarà errata e non sarà in grado di svolgere le sue funzioni. D'altra parte, un vaccino progettato per la "versione" precedente potrebbe non funzionare contro una proteina alterata.

Passa attraverso il ciclo attraverso tutti i genomi, trova il gene s-proteina e cerca i sostituti rispetto alla versione iniziale del 2019; queste sono diverse decine di linee di semplice programmazione.

I grafici lineari o a barre tradizionali non sono adatti per la visualizzazione di 3822 nucleotidi e loro sostituzioni. Per chiarezza, è più conveniente disporre la sequenza nucleotidica come testo, da sinistra a destra, dall'alto verso il basso e sostituire la presenza della mutazione e il loro numero con il colore del campo:

I colori indicano il numero di varianti per una data "lettera" tra i genomi analizzati. Ad esempio, giallo significa che per un dato nucleotide, ci sono tutte e tre le possibili varianti di una mutazione e ognuna di esse porta a una molecola proteica leggermente diversa. Se esiste una sola mutazione per una lettera e quella mutazione è innocua, il colore è il più vicino al viola iniziale.

Animazione giornaliera:

Le mutazioni, per dirla in parole povere, sono presenti, non una o due, e la maggior parte non sono sinonimi. Cioè, quelli che modificano la proteina del picco del coronavirus. Ma molto o poco nel contesto di una mutazione virale e dei vaccini?

I ricercatori affermano che il coronavirus SARS-CoV-2 muta relativamente lentamente. Ad esempio, l'influenza stagionale muta molte volte più velocemente. Cioè, ci si può aspettare che i vaccini che sono già sottoposti a sperimentazioni cliniche sull'uomo in sette laboratori saranno rilevanti ed efficaci per un lungo periodo di tempo. Se è così, stiamo aspettando il vaccino! =)

Lupi e lepri in grafica e ritratti

Succede che cose brillanti vengono alla mente di due persone contemporaneamente. Come succede? Perché loro? Nessuna risposta. Ma a seguito di tale attività cerebrale, i matematici americani e italiani hanno proposto un modello di interazione "predatore - preda". Non hanno discusso e maledetto su colui che è più geniale di loro, il frutto dei loro pensieri porta il nome di entrambi: l'equazione di Lotka - Volterra.

Bene, ci sono predatori, bene, ci sono vittime. Perché c'è una cosa del genere? A meno che, naturalmente, questi siano predatori di una serie di film con lo stesso nome. Pensaci. Sembra ovvio che un predatore mangia le vittime, per questo sono vittime. Tuttavia, anche tali fenomeni in qualche modo spontanei possono essere spiegati matematicamente.

Considera l'opzione più semplice. Nel ruolo di un predatore ci saranno i lupi, nel ruolo di una vittima - lepri. Le lepri afferrano le piante. Tutti gli animali vivono in un'area limitata, ma l'erba ha il tempo di crescere, in modo che le orecchie non vivano in povertà. Ora rimuovi dallo schermo donne, bambini e deboli di cuore. Iniziamo con il fatto che il numero di lepri si riferisce al numero di lupi 3: 1. Il sistema vive, le lepri saltano e il lupo nutre le sue gambe. Entrambe le popolazioni crescono e godono della loro ipotetica vita. Quindi il numero di predatori raggiunge una certa cifra, essi, come qualsiasi organismo, si nutrono, il numero di lepri diminuisce. Il fatto è che il consumo sta diventando così grande che la popolazione semplicemente non ha tempo di riprendersi. A proposito, non tutta l'energia va ai predatori da una lepre, ma solo il 10%, quindi un lupo mangia diverse lepri. Man mano che il cibo diventa scarso, è logico che i predatori inizino a morire. Questo continua fino a quando il numero di vittime non può raggiungere il livello di crescita della popolazione. Fino ad ora, i predatori stanno calando. Ma poi sia i lupi che le lepri crescono. E le popolazioni stanno di nuovo crescendo, il sole splende, la vita è bella. E poi ci sono molti lupi, mangiano lepri, ci sono poche lepri, anche i lupi muoiono. L'hai già visto da qualche parte? Ti dirò dove: alcune righe indietro. Non è un giorno della marmotta, tutto si sviluppa ciclicamente.

E in che modo questo è legato a un computer? Un programma in cui sono guidati i dati per l'equazione di Lotka-Volterra può costruire grafici che, di fatto, trasporteranno la mia narrazione. Puoi vedere il grafico della funzione, il ritratto di fase, che è una curva concentrica chiusa attorno a un punto stazionario, e la traiettoria di fase - lo stesso ritratto di fase, solo 3D (vedi grafici 1)

Oltre a un sistema così idealizzato, è possibile apportare modifiche. Ad esempio, puoi aggiungere un elemento di competizione nella stessa vista. Hai mai preso l'ultimo biscotto da un pacchetto? E i lupi possono mordersi l'un l'altro. E le lepri possono usare la propria prole. Questa è la vita. Ma l'immagine risulta più interessante. Nel grafico, le funzioni di fluttuazione non sono le stesse, la loro ampiezza diminuisce di una certa quantità man mano che diminuisce il numero di predatori e prede, poiché la competizione intraspecifica riduce ulteriormente il numero di ciascuna specie fino a quando il numero di entrambi i tipi raggiunge un certo numero, in cui gli animali possono disperdersi in tutto il territorio in modo che la competizione intraspecifica non li distrugga così tanto. Nel ritratto di fase, questo non sembrerà una curva chiusa, ma come quello che vediamo, drenando l'acqua, tutto tenderà a questo punto fermo, il punto di equilibrio e pace. (vedi grafici 2)

Se l'inizio del nostro ipotetico sistema fosse solo il punto fermo, allora tutto sarebbe il contrario: le popolazioni sarebbero cresciute. Sul grafico, le funzioni di ampiezza aumenterebbero nel tempo e nel ritratto di fase la retta non ruoterebbe verso il centro, ma ruoterebbe da essa, illustrando la crescita delle popolazioni. (vedi grafici 3)

Ci sono altri modelli che non sono così suscettibili al cambiamento. Tale è il modello Holling-Tanner. Se assumessimo un diverso atteggiamento delle vittime nei confronti dei predatori, ad esempio, se fossero equamente divisi, il sistema cercherebbe di tornare a uno stato stabile. Nel tempo, le lepri in relazione ai lupi diventerebbero 3: 1. Se avessimo esattamente due lepri e due lupi, allora un predatore non avrebbe ovviamente abbastanza vittime. Ma le lepri si riproducono rapidamente. Nonostante siano mangiati, la popolazione avrebbe ancora il tempo di crescere. E poi il sistema sarebbe arrivato a ciò che è stato descritto in precedenza. Sul grafico, vedremmo un aumento dell'ampiezza e quindi dei periodi identici. E nel ritratto di fase, tali modelli hanno cicli limite. La linea girerebbe dal punto 2; 2 a questo ciclo limite. Una linea retta da un punto fisso 3: 1 verrebbe attorcigliata in un ciclo. (vedi grafici 4)

Se assumiamo che i parametri nell'equazione non siano costanti, ma coefficienti che dipendono dal numero di vittime, il quadro sarà diverso. Prendiamo due parametri che dipendono inversamente l'uno dall'altro. Lascia che sia la saturazione del predatore e il suo tasso di riproduzione. Se la saturazione è alta, i conigli hanno bisogno di meno. Poiché esiste una relazione inversa tra i parametri, la discendenza dei lupi è lenta. Entrambe le popolazioni diminuiranno gradualmente per stabilizzarsi a un livello diverso da zero. Sul grafico, l'ampiezza diminuirà, alla fine sarà quasi una linea retta. Il ritratto di fase illustra la stessa cosa: la linea si arriccia fino a raggiungere un punto diverso da zero per il sistema. (vedi grafici 5)

Quindi, guardando i grafici, puoi "leggere" l'intera storia delle popolazioni. Questo è molto eccitante. È interessante che i modelli possano essere utilizzati non solo in relazione agli animali, ma anche per l'economia, la politica, gli affari. Puoi persino organizzare la predizione della fortuna sui grafici secondo l'equazione di Lotka-Volterra. Bene, cosa non è un'alternativa ai fondi di caffè? Ancora più affidabile.

Il primo rilevamento di proteine ​​di dinosauro e DNA

Non abbiamo avuto il tempo di ridere delle false notizie sulla creazione di un embrione T-rex da un uovo di gallina, come un articolo scientifico di Alida M. Bailleu et al., Intitolato "Evidenza di proteine, cromosomi e marcatori chimici di DNA nella cartilagine di dinosauro eccezionalmente conservata "-" Segni della presenza di proteine, cromosomi e marcatori di DNA biochimici nella cartilagine di dinosauro eccezionalmente ben conservata "fornisce la prova della conservazione di proteine ​​e acidi nucleici in un campione di dinosauro Hypacrosaurus stebingeri (illustrato) di circa 65 milioni di anni. https://academic.oup.com/nsr/article/doi/10.1093/nsr/nwz206/5762999

Fig 1. Aspetto di campioni di dinosauro Hypacrosaurus stebingeri e di un campione di controllo (moderno struzzo Emu) rilevazione microscopica di oggetti che assomigliano a cromosomi e cellule in divisione.

A. Vista generale di un campione di Hypacrosaurus (MOR 548) della vertebra cervicale. B. Micrografia di lacune cartilaginee calcificate. Strutture C-D che assomigliano a cellule in divisione e cromosomi di dinosauro ad alto ingrandimento. E. Un campione di controllo della vertebra cervicale del moderno struzzo Emu. F. Tessuto cartilagineo del campione di controllo. Cellule G congelate nel processo di divisione e materiale cromosomico nel campione di controllo.

Fig 2. Colorazione blu alkiana (marker di cartilagine) di fette di dinosauro e esemplare di struzzo di struzzo.

Aspetto di campioni di A. tessuto cartilagineo di un dinosauro e osso B di un dinosauro. La colorazione blu alcalina della cartilagine C rivela una macchia blu (tipica dei condrociti, cellule della cartilagine). D. Colorazione minima dell'osso di dinosauro con il blu di Alcian. I campioni di controllo E-H dello struzzo emu mostrano anche una colorazione blu brillante della cartilagine e dell'osso minimo.

Questo risultato mostra che nei campioni la cartilagine del dinosauro non è in realtà un altro tessuto.

Fig 3. Rilevazione del DNA nei condrociti (cellule della cartilagine) del dinosauro Hypacrosaurus stebingeri

Colorazione delle cellule di cartilagine di dinosauro (A-B), propidio ioduro (C) e DAPI (D) per DNA / acidi nucleici. (E-G) Emu Ostrich Controls.

Fig 4. Rilevazione della proteina Chagen Collagen II nel materiale della cartilagine del dinosauro Hypacrosaurus stebingeri

ANNO DOMINI. Analisi di immunofluorescenza di anticorpi contro la proteina Chagen Collagen II (segnale verde) in sezioni ultrasottili di materiale Hypacrosaurus stebingeri e cartilagine del moderno struzzo Emu (E-H). Per confermare che si tratta di collagene II, gli autori hanno processato campioni di struzzo di dinosauro (C-D) ed Emu (G-H) con collagenasi II che decomprime specificamente il collagene II e ha ricevuto la prevista riduzione dell'intensità del segnale. Per confermare che si tratta del collagene II, e non di qualsiasi altra proteina con cui gli anticorpi si legano in modo non specifico, gli autori hanno colorato gli stessi campioni con anticorpi contro il collagene I che normalmente non è presente nel tessuto cartilagineo e non ha ricevuto un segnale. I materiali supplementari all'articolo forniscono anche la colorazione di controllo senza anticorpi contro Chick Collagen II per escludere la colorazione non specifica del campione con anticorpi secondari con un marcatore fluorescente (cromoforo verde) che si lega specificamente agli anticorpi primari con Chick Collagen II, la mancanza di segnale nel campione di controllo ha confermato che davvero Chick Collagen II e non un fenomeno casuale.

Dopo aver letto l'articolo, dalle mie critiche personali mi piacerebbe molto vedere la colorazione di ioduro di propidio e campioni DAPI sui quali sono visibili i cromosomi (Fig. 1), entrambi i coloranti dovrebbero macchiarli. Tuttavia, è probabile che i cromosomi congelati durante il processo di divisione possano subire una maggiore degradazione rispetto alle cellule imballate nel nucleo e sopravvivere solo esternamente senza il contenuto di acidi nucleici. In termini di aspetto del materiale colorato, questo è esattamente l'aspetto dei nuclei cellulari. Non posso non notare che il nucleo del dinosauro sembra molto più piccolo del nucleo normale in una cellula ordinaria di mammiferi moderni, nel rapporto tra la dimensione del nucleo e la cellula, ma poiché abbiamo a che fare con un campione così antico di milioni di anni, la dimensione ridotta può essere associata alla degradazione degli acidi nucleici nel campione.

Questi risultati mettono in dubbio quanto pubblicato nel 2012 da Morten E. Allentoft et al, ipotesi su un'emivita del DNA di circa 500 anni e l'impossibilità fondamentale di isolare e studiare il DNA dei dinosauri. https://royalsocietypublishing.org/doi/full/10.1098/rspb.2012.1745. Naturalmente, dalla scoperta degli acidi nucleici, al genoma dei dinosauri completo o almeno parziale, un enorme abisso. Tuttavia, il passo logico successivo è quello di ritagliare i nuclei delle cellule dal campione con un laser e cercare di estrarre il DNA per la sequenza genomica e l'allineamento con il genoma di riferimento degli uccelli, lo stesso struzzo Emu. Quante volte negli archivi sono accettabili immagini di conservazione per l'isolamento di proteine ​​e acidi nucleici e in quali condizioni si trovava il campione, il che ha permesso di identificare proteine ​​e acidi nucleici richiede ulteriori studi.

Notizie n. 1002: i pipistrelli hanno abbassato la voce per le banane

Notizie n. 1001: cavallucci marini adattati alla gravidanza come esseri umani

Partiti (parte seconda. Chi sei. Non ti ho chiamato. Lascia.)

Ooooh. Solo ora ho capito che tipo di bravi ragazzi ho scritto tutti i post precedenti. Voglio inchinarmi a tutti loro in gambe, a tutti, dal plesiadiscript a ogni sorta di homos. I bambini erano gentili e responsabili. Qui hai ossa del genere, ma altri, guarda qui, un teschio quasi solido, ma vai lì, scava, c'è uno scheletro quasi intatto per te.

Grazie a quegli homo sapiens che corrispondono davvero a questo nome, agli scienziati - bolliti. Tutti indagati, tutto descritto (non metterò l'accento). Ho iniziato a dire, ho dimenticato qualcosa o non lo sapevo - non è un problema! Prese un libro dallo scaffale, lesse il capitolo necessario, guardò un paio di lezioni sul tutorial, guardò le foto sul sito tematico e proseguì, scrisse e rallegrò! Grazie a tutti loro.

Non è tutto Shrovetide per gatti.

Chi è il sig. denisovets?

I Denisovani (homo heidelbergensis dell'Asia) sono tre denti pesanti e un pezzo di dito, come questo.

Un pezzo di falange del mignolo (a destra, se quello.):

C'è una carrozza e un carretto nella grotta di Denisova (da cui il nome), il problema è che tutti i tipi di creature vivevano lì per 300 mila anni, Denisovani, Neanderthal, Sapiens, i loro meticci e l'inferno sa chi altro. Due denti, ora denominati Denisovani, furono ritrovati in epoca sovietica, durante la grande estinzione dei segretari generali, e sono stati a lungo descritti come "Neanderthaloids". Lo avrebbero descritto ora, probabilmente allo stesso modo, ma recentemente hanno finalmente imparato a lavorare e i signori della genetica hanno iniziato a portare benefici reali, l'aspetto dell'uomo di Denisov è il loro merito. E sebbene al paleoantropologo classico non piaccia davvero trarre conclusioni solo sulla base del DNA estratto, in questo caso semplicemente non c'è altro modo.

Okay, non uscirò più, volevo proprio questo alla fine. Meno di un anno fa, i nostri amici cinesi hanno finalmente studiato e descritto questa cosa trovata molto tempo fa in Tibet. I. Niente, soprattutto cambiato.

Grande mascella con grandi denti. Inoltre, le persone intelligenti sono riuscite a sradicare alcune proteine ​​da esso, estrarre il DNA da loro - e, voilà! Denisovsky amico, ciao caro! C'è ancora un teschio interessante da alcuni Huimulundun, o qualunque cosa sia, ma non è ancora stata adeguatamente studiata, non è chiaro di chi aspetteremo. Ora ci saranno molti pretendenti, gli antropologi cinesi smetteranno presto di resistere (si aspettano ancora gente moderna dall'Asia, ma mi scusi, voglio rispondere con il famoso detto di Vadim Yevseyev. No, non lo farò all'improvviso, che non ha diciotto anni). Vangyu, tra un anno, cinque o dieci, saremo in grado di parlare di Denisovan con la stessa sicurezza dei Neanderthal, perché in Cina sono state scavate molte cose, nemmeno più scavate, e il Tibet è rimasto quasi intatto fino ad ora.

Nel frattempo, abbiamo conclusioni scientifiche.

Una volta, alcuni homo erectus sono usciti dall'Africa, privandosi così dell'opportunità di diventare persone razionali (homo sapiens), ma sono stati in grado di generare diverse umanità parallele e di quanti non abbiamo idea, nessuno lo sa.

È chiaro che coloro che sono fuggiti dall'Africa hanno iniziato ad evolversi in una vena leggermente diversa rispetto ai nostri diretti antenati africani, e ad un certo punto, quelli che hanno lasciato e si sono spostati a destra sono diventati specie diverse e l'uno rispetto all'altro. La genetica è una scienza giovane e inesperta, i numeri sono diversi, quindi 700 mila anni, poi 500 mila anni, quindi un altro numero di migliaia di anni, in breve, all'inizio ci hanno lasciato e poi si sono disconnessi. Considerando che kirdyk è venuto a tutti, possiamo dire con certezza che era necessario rimanere con noi e non rifuggire da nessuna parte.

Sfortunatamente, la genetica non è quasi in grado di aiutare a ripristinare l'aspetto dell'uomo di Denisov, per ora è solo chiaro che avevano denti e mascelle grandi, capelli e occhi scuri e che anche la loro pelle era scura, molto probabilmente.

Ma ciò che i genetisti amano e sanno come fare è cercare le impurità. Dicono che non puoi nemmeno dar loro da mangiare, troviamo solo un po 'di impurità. E fu naturalmente trovata anche una mescolanza di Denisovan nelle persone. I seguenti suggerimenti, sconsiglio vivamente di leggere a razzisti, Ku Klux Klanites e altri fan del potere bianco, non accendono la tua scoreggia. Quindi, in base al genoma umano, gli unici sapiens di razza rimasta sul pianeta sono i neri africani, che, seguendo i precetti dei loro antenati, continuano a frequentare l'Africa. Noi, la stragrande maggioranza della popolazione mondiale, abbiamo un pezzo del genoma di Neanderthal in noi. Ma i papuani, gli aborigeni australiani, alcuni melanesiani, alcuni cinesi del sud e altri residenti nella regione Asia-Pacifico, anche apparentemente eschimesi, portano l'eredità di Neanderthal e Denisovans. Pancake di mezza razza, hehe.

Bene, quindi, geografia, cronologia e logica entrano in battaglia. Lo chiamerei "MTK" (metodo scientifico del poke). Ti esorto a non disdegnare questo metodo, il tuo umile servitore, con il suo aiuto, ha più di una volta consegnato la fisica, l'iscrizione e altri enigmi perversi per la superintelligenza (no, geometria descrittiva - imbrogliando. Scribbling. Ugh, dannazione qui.).

Allora, cosa abbiamo? La miscela con i sapiens apparentemente si è verificata da qualche parte nel sud-est dell'Eurasia (India, Cina meridionale, Indonesia) e abbiamo scavato i loro pezzi patetici nella nostra Altai, da cui si è concluso che l'habitat dell'uomo di Denisov proveniente da Altai (il confine della Federazione Russa, Cina e Mongolia) in Indonesia, nelle Isole Filippine, in generale, in tutta l'Asia orientale. E poi i nostri Denisoviti, che provengono dalla grotta di Denisova, sono probabilmente miserabili perdenti, scacciati fino al limite settentrionale. Sfortunatamente, il DNA non può essere isolato dalle scoperte più meridionali, è stato anche immagazzinato in un clima caldo e quelli dei quali sono ottenuti, quindi sapiens.

Basandosi su questa logica geografica, gli antropologi moderni stanno cercando di legare i Denisovani ai sinantropi (fino ad ora una sottospecie di homo erectus).

Ma i sinantropi sono più vecchi e i denti sono più piccoli. I tuoi denti sono cresciuti? Tipi diversi? Grande diversità intraspecifica? Sconosciuto. Non abbiamo DNA dal sinantropo, non abbiamo un intero cranio da Denisov, non abbiamo nemmeno un volto intero da signore e signori, scavando bastoni nelle nostre mani, mani nelle gambe e scavare, scavare e ancora scavare. Genetica oculare al microscopio e anche arbeiten, schnelle-schnelle. Nel frattempo, come tutti gli altri, considereremo i Denisoviti i discendenti dei sinantropi.

In generale, a differenza dell'Europa, dilaniata e attraversata, e persino dell'Africa, dobbiamo ancora studiare e studiare l'Asia. Data la distanza e la diversità dell'ambiente, quante persone troveremo lì e come saranno correlate tra loro, si può indovinare fino al blu. In breve, voglio catturare un paio di residenti sull'isola.

E la gente di Ngandong sarà la prima, il nome normale per loro non è ancora presente. È chiaro che questi sono i discendenti di erectus che hanno raggiunto l'isola di Java, il bordo della Terra. Gli stessi Ngandong sono attribuiti all'erectus o al sapiens e potrebbero anche essere Denisovani, perché no? Il fatto è che gli antenati raggiunsero Giava ancora via terra, un milione o un milione e mezzo di anni fa, quindi il livello del mare salì e scese, ma pochi arrivarono di lato, quindi i Ngandoniani si sono evoluti a modo loro per centinaia di migliaia di anni.

E si sono evoluti in diversi segni molto specifici che non si trovano in altri compagni fossili. Secondo la tradizione consolidata, non mi preoccuperò dell'unicità dell'assenza dei processi articolari posteriori dell'osso temporale e di altri condili occipitali. La crescita di uno degli individui è stata stabilita, circa 1,65 m - molto mediocre. Il volume medio del cervello per tutti i crani è di 1.100 cm³ - mediocre e noioso.

È interessante notare che tutti i 14 frammenti di teschi e diverse ossa sono state trovate, infatti, in un posto, qui include la fantasia, cammina il difetto! Festa del cannibale mangia-cervello? Boschi recisi pendevano attorno al perimetro? Sì, può benissimo essere, visto il danno ai teschi. Ma potrebbe non esserlo, considerando che questo tesoro è stato trovato sulla riva del fiume, in strati altamente misti. Quali pietre martellavano su di loro? Quali animali li hanno rosicchiati? Sconosciuto.

I Ngandongchan hanno lasciato qualche segno sull'uomo moderno? Alcuni studiosi occidentali stanno cercando di legarli agli aborigeni australiani, ma non funziona, beh, scusa, Mikhail Zadornov ci ha lasciato, dimostrerebbe rapidamente che quelle persone di Ngandong, queste sono persone moderne di Hong Kong, e chiuderebbero l'argomento. I Ngandongchins erano ragazzi molto specifici, non c'era niente come noi, si sono estinti, sembra, molto prima dell'arrivo dei sapiens, il che non sorprende, l'isolamento raramente porta a qualcosa di buono (sto parlando di evoluzione, se questo).

E soprattutto, il ritardo dello sviluppo in isolamento, è dimostrato dai nostri ultimi eroi oggi, homo floresiensis, è un uomo floresque, è uno hobbit dell'isola di Flores (50 - 100 mila anni fa).

All'inizio, circa un milione di anni fa, salparono per Flores, furono loro a salpare, a quanto pare dall'isola di Giava, i comuni pitecantropi, gli eretti locali, furono anche trovati, tutto andava bene, ma poi, nelle condizioni chiuse di una piccola isola, iniziò il divertimento.

L'evoluzione sulle isole, in linea di principio, ama stranamente, per esempio, aumentare qualcuno al gigantismo.

Diciamo che il pappagallo Kakapo, così grande per un pappagallo (fino a quattro kg di peso), che ho dimenticato come volare.

E sullo stesso Flores viveva con gli hobbit e vive ancora la lucertola di Komodo, la lucertola più grande del mondo. Il dannato dinosauro è in grado di pesare fino a 100 kg ed essere lungo fino a 2,5 metri. Considerando che piccoli coccodrilli, cinghiali, cani, bovini e così via sono inclusi nella dieta dei dinosauri bruciati, penso che gli abitanti di Flores ne abbiano sofferto, non si scherzano affatto.

Di recente, le cose sono andate peggio per loro, indovina chi le soffoca e le soppianta?

L'evoluzione dell'isola manda gli altri nella direzione opposta, giocando con loro - chi è il nano qui? Di solito non sono fortunati con artiodattili, predatori a sangue caldo e proboscide, non so a quale di questi sviluppi si riferisse l'arrivo del Pitecantropo, ma in meno di un milione di anni (anche meno, molto meno) si sono ridotti notevolmente.

Non è diminuito qualcosa, ma tutto. Poiché nella caverna di Liang Bois è stato trovato quasi un intero scheletro, tra l'altro ne sappiamo molto. Sono lieto che dai primi reperti siano state fatte ipotesi e conclusioni, che sono state confermate da successivi ritrovamenti in Mata-Menga, dove hanno trovato resti dell'età di 650 - 800 mila anni, e appartengono chiaramente all'intermedio, tra il Pitecantropo e gli hobbit, specie. Ad esempio, i denti sono già piccoli, più piccoli dei nostri, ma la struttura è uguale a quella del pitecantropo. Lo stesso con la mascella e il cranio nel suo insieme. La rapidità dell'evoluzione isolata è interessante, un milione di anni fa - i soliti Pithecanthropus, come tutti gli altri, e dopo trecentomila anni, o anche meno, sono nani. L'essiccazione è confermata dagli strumenti trovati, se i primi arrivati ​​avevano buoni elicotteri a grandezza naturale della cultura acheuleana, come tutti gli altri, quindi gli strati successivi avevano già piccoli fiocchi. Ma perché le mani sono diminuite!

In media, la crescita del popolo fiorentino era di un metro, forse un po 'più grande, un naso largo, una mascella senza sporgenza del mento, in generale il cranio è più simile al primo homo, molto estinto lontano in Africa. Braccia molto lunghe e proporzioni di arti in generale, come Australopithecus! Australopithecus bl. 2 milioni di anni fa vivendo! E la ragazza (l'intero scheletro hobbit - quello femminile) ha meno di centomila anni. Il polso è completamente diverso da chiunque. Sì fichi con loro, con arti, sai cos'altro c'era a livello di Australopithecus? Cervello. 400 - 450 grammi. Come gli scimpanzé moderni. 2 -2,5 volte in meno rispetto agli antenati che salparono per l'isola. Tuttavia, ciò non sorprende, gli ippopotami del Madagascar, gli elefanti a Malta e altri isolani nani hanno perso il loro volume del cervello più e più velocemente delle dimensioni del corpo.

Ma! Questo è ciò che è importante, per molti anni è esistito il concetto di "rubicone del cervello", si credeva che qualsiasi attività "umana" fosse possibile solo quando si raggiungeva un certo volume del cervello. 700, 900 grammi, le opinioni erano diverse. Qualcosa del genere, l'Australopithecus ne aveva di meno - erano stupidi, non potevano fare nulla, ma il primo Homo Rubicon attraversò e si precipitò - la fabbricazione di strumenti, i tentativi di comunicare e così via. E presero delle piccole fioriture di omosessuali e lo spaccarono su una testa intelligente. Tutti gli scienziati contemporaneamente. Avendo perso metà del loro cervello, hanno continuato a produrre strumenti semplici, bastoncini affilati, cacciare elefanti nani (stegodon), in altre parole, in qualche modo sono riusciti a preservare la cultura con cui sono arrivati ​​sull'isola. O perdendo i meandri, abbiamo mantenuto il più importante o abbiamo sottovalutato l'importanza della formazione e del trasferimento delle conoscenze, ma in qualche modo siamo stati in grado di.

Bene, gli hobbit, come molti altri, ci stanno dicendo: "Non pensare di sapere tutto, guarda e studia il più a lungo possibile".

Su questo, forse, fermerò il mio carrello. Bene, se non sei stanco, allora scriverò qualcos'altro.

Notizie n. 998: i gamberi di mantide sono tornati a casa attraverso l'integrazione dei percorsi

In che modo i virus rompono le nostre cellule? Spiegazione in 10 immagini

Un vero virus, come un virus informatico, non è altro che un codice di programma. Perché le nostre cellule accettano rispettosamente un programma straniero? Leggi le didascalie delle immagini per capire.

1. Qualsiasi cellula vivente è una fabbrica di proteine. Quasi tutte le strutture cellulari sono costituite da proteine. E le proteine ​​stesse, come i mattoncini Lego, sono costruite con aminoacidi: molecole piccole e semplici. Solo 20 aminoacidi sono coinvolti nel corpo umano.

2. Alla fabbrica di celle lavorano robot - enzimi. Queste sono anche proteine, ma complesse. Possono combinare e scomporre varie molecole, controllare le reazioni chimiche. Nelle cellule umane, circa 1300 tipi di enzimi. Ad esempio, la lattasi scompone il lattosio in proteine ​​del latte in galattosio e glucosio..

3. Gli enzimi vengono prodotti qui, in una fabbrica di cellule, insieme ad altre proteine. Per fare questo, la cellula contiene una serie di documenti di lavoro - DNA. Tutti i geni per la costruzione di tutte le proteine ​​del corpo sono registrati qui. La lunghezza delle molecole di DNA di ogni cellula è di quasi 2 m, sono compattate e racchiuse in 46 cromosomi..

4. Il DNA è un Talmud che descrive la struttura dell'intero organismo. L'enzima RNA polimerasi si muove lungo il DNA e copia i singoli fogli di questo Talmud su molecole di RNA. Una foglia, un gene, è costituita da codoni che indicano alcuni aminoacidi. I codoni di apertura e chiusura indicano all'enzima quando tagliare il foglio finito e iniziare a stamparne uno nuovo. Ogni RNA è un disegno di una proteina o un enzima..

5. I ribosomi sono "macchine" su cui vengono prodotti gli enzimi. Non appena l'RNA con l'istruzione si avvicina al ribosoma, collega gli amminoacidi nella sequenza desiderata. La catena risultante stessa collassa in una struttura spaziale e si ottiene un nuovo enzima.

6. Amminoacidi, enzimi, RNA: galleggiano tutti nel citoplasma liquido della cellula, muovendosi liberamente e interagendo tra loro. I virus usano questa libertà.

7. Un virus tipico è un pezzo di DNA o RNA in una scatola di proteine. Non è nemmeno vivo - non ne ha bisogno. Questo è solo un programma, un codice per enzimi stranieri. Raggiunto la cellula ospite, questo parassita lancia il proprio RNA.

8. Dopo aver incontrato l'RNA virale, il ribosoma produce diligentemente dettagli sui virus: nuove buste e copie dell'RNA. Gli enzimi cellulari aiutano a raccogliere molte copie del virus. I virus pronti escono dalla cellula.

9. Esistono diverse varianti di virus. Ad esempio, i retrovirus possono integrare le loro istruzioni direttamente nel DNA della cellula ospite. Il DNA umano contiene un'enorme quantità di geni della spazzatura che si sono accumulati dopo incontri con tali agenti. I coronavirus prendono parte della membrana della cellula ospite con loro come membrana aggiuntiva.

Lo schema interattivo del virus, vedere qui: in2minutes.ru

Notizie n. 994: i chitarristi jazz eseguono l'improvvisazione senza controllo cognitivo

Una complessa storia della popolazione e modelli di impurità nella razza umana. Neanderthal, Denisovans, erectuses, ecc.

L'impurità è dominante nella formazione di modelli di variazione genetica. Un confronto delle sequenze dei genomi di persone antiche e moderne ha registrato numerosi casi di croci, incluso il flusso di geni da Neanderthal e Denisovans, così come dai primi moderni a Neanderthal. Tuttavia, i risultati e le difficoltà relativamente rari nell'ottenere il DNA antico rendono difficile analizzare il contributo delle popolazioni antiche alla diversità genetica delle persone. Ma qui vengono in soccorso nuovi metodi, che ci consentono di determinare antiche impurità, e ogni anno questi metodi diventano più precisi.

Questo articolo ha raccolto alcuni degli ultimi dati dal lavoro di quest'anno. Parleremo di persone anatomicamente moderne del passato relativamente recente dell'Africa occidentale e di Neanderthal, Denisovan e i loro antenati con uno strano nome: Neanderthans, che a sua volta si mescolò con una popolazione più anziana, probabilmente erectus, che stabilì l'Eurasia per 1,9 milioni di anni indietro.

Inizierò con un passato meno distante.

Devo dire subito che molte persone spesso commettono lo stesso errore, fraintendendo il clima del passato e l'Africa non fa eccezione. Ad esempio, nuovi dati ottenuti attraverso l'analisi della fauna dai 10.200 ai 4.650 anni dalla caverna Takarkori nel deserto del Sahara in Libia. Dove sono stati trovati i resti di pesci, come i ciclidi e il pesce gatto, così come gli animali che sono stati mangiati dagli abitanti della grotta.

Pertanto, rappresentando le regioni dell'Africa, vale la pena tenere conto della differenza di clima in periodi diversi, perché alcune regioni erano un tempo umide e ricche di acqua e di vita, come dimostrano i reperti di numerosi insediamenti umani e la diversità della fauna.

Antichi cacciatori e raccoglitori dell'Africa occidentale nel contesto della storia della popolazione africana

In un articolo pubblicato nel febbraio di quest'anno, gli autori citano il DNA dell'intero genoma di quattro bambini di età compresa tra 8.000 e 3.000 anni dalla caverna di Shum Lak in Camerun, uno dei primi siti archeologici conosciuti all'interno della probabile patria del gruppo linguistico Bantu - la famiglia Benue-Congolese. Sebbene siano state analizzate in totale 18 persone, il DNA di solo 3 ragazzi dai 4 ai 15 anni e una ragazza di 4 anni è risultato adatto per ulteriori analisi. In ogni caso, questi sono i primi genomi di questo territorio..

I bambini più grandi avevano l'aplogruppo mtDNA L0a2a1, che è abbastanza comune in Africa e negli aplogruppi del cromosoma Y B e A00. L'aplogruppo B è comune tra i moderni cacciatori e raccoglitori dell'Africa centrale e A00 è la linea più antica che è apparsa da 200 a 300 mila anni fa.

L'analisi ha mostrato che i cacciatori e i raccoglitori moderni non sono discendenti della popolazione i cui rappresentanti sono sepolti nella grotta di Shum Lak, come la maggior parte dei moderni oratori Bantu. I rappresentanti di Noise Luck sono geneticamente più vicini agli oratori del gruppo di lingue bantoide di Grassfield. E vissero nella regione per almeno 5 mila anni, dopo di che furono sostituiti da gruppi eterogenei di persone i cui discendenti abitano attualmente in questi territori.

Sono stati identificati 3 principali centri di ramificazione delle popolazioni con 4 linee separate, che sono più facili da percepire sul grafico. Va notato che i punti nodali non significano divergenza e sequenza simultanee, ma indicano solo schematicamente un intervallo di tempo relativamente piccolo.

I punti chiave sono:

1. La prima divisione delle persone in popolazioni associate a cacciatori-raccoglitori dell'Africa centrale circa 300-200 mila anni fa (nero), in cacciatori-raccoglitori sudafricani circa 250-200 mila anni fa (rosso), in altre popolazioni di persone moderne (colore arancione) e ad una popolazione sconosciuta per la quale non vi sono dati (blu). La linea connessa con i cacciatori-raccoglitori dell'Africa centrale, a sua volta, è divisa in orientale e occidentale e quest'ultima conduce ai rappresentanti di Shum Lak.

2. Questo nodo si divide nella linea basale dell'Africa occidentale (colore verde), nella popolazione di persone che successivamente andarono oltre l'Africa (giallo), in allevatori di animali dell'Africa orientale (lilla) e nella popolazione associata all'abitante della grotta etiope Mota, età 4500 anni. L'isolamento di una popolazione associata a tutti i non africani è avvenuto tra 80 e 70 mila anni fa. Ciò è coerente con la fillogeografia del mtDNA, in particolare con l'isolamento dell'aplogruppo L3, che probabilmente ebbe origine nell'Africa orientale circa 70.000 anni fa. È anche coerente con l'isolamento dell'aplogruppo del cromosoma Y CT nello stesso periodo. Queste mutazioni sono presenti in tutte le moderne linee umane maschili, ad eccezione di A e B-M60.

3. Il sito è associato con l'estensione del pedigree associato ai madrelingua di Bantu.

Nel complesso, i risultati confermano le recenti argomentazioni di genetisti e archeologi secondo cui l'origine dell'uomo in Africa potrebbe includere popolazioni profondamente divergenti e geograficamente separate. Ma vale anche la pena notare la presenza nell'area della discrepanza con i Neanderthal un'altra sconosciuta stirpe ancestrale.

Individuazione e interpretazione di un pedigree esplicito di Neanderthal tra gli africani

L'essenza di questo studio è di descrivere una nuova tecnica che consente di rilevare antiche impurità nei genomi delle persone moderne. La più interessante è stata la scoperta di un genoma di Neanderthal dello 0,3% negli africani.

Sebbene in precedenza si credesse che solo le popolazioni non africane avessero una miscela di Neanderthal, circa il 2%. È interessante notare che alcuni degli aplotipi rilevati sono associati a una reazione alla luce ultravioletta. Ma gli africani non potevano incontrarsi con i Neanderthal. Inoltre, il 94% delle impurità di Neanderthal negli africani è presente in persone al di fuori dell'Africa. I risultati di ulteriori studi hanno mostrato che c'era una migrazione inversa in Africa, persone già con impurità di Neanderthal. Ma anche, in misura minore, c'era una mescolanza dai sapiens ai Neanderthal prima che la gente moderna lasciasse l'Africa. Inoltre, il nuovo metodo ha mostrato che le tracce di Neanderthal nelle popolazioni asiatiche sono più dell'8% in più rispetto a quelle europee, sebbene in precedenza si credesse che questa differenza fosse del 20%.

In generale, il metodo è piuttosto interessante, ma funziona solo nel caso della ricerca del contributo genetico di popolazioni antiche conosciute, il cui genoma è già stato sequenziato.

Ma nel prossimo lavoro, pubblicato meno di 2 settimane dopo, dopo quanto sopra, era già stato utilizzato un metodo per determinare l'uso di quale è possibile identificare segmenti di DNA di origine antica senza la presenza di un campione sequenziato del genoma dei loro portatori.

Segnale di restauro di un'impurità antica sconosciuta nelle popolazioni africane

In questo lavoro, i ricercatori hanno fornito ulteriori linee di prova per le impurità arcaiche in quattro popolazioni dell'Africa occidentale. Queste popolazioni sono rappresentate dal popolo Ishan del sud della Nigeria, dal popolo gambiano, dal popolo Mende in Sierra Leone e da un gruppo di popoli yoruba della Nigeria. L'analisi ha mostrato che queste popolazioni hanno ricevuto dal 2 al 19% della loro origine genetica dalla popolazione antica, che proviene da una linea comune alla separazione di Neanderthal e umani moderni.

E questo contributo è stato riscontrato anche nelle popolazioni europee, che conferma il tempo dell'impurità prima della liberazione di persone anatomicamente moderne dall'Africa. Utilizzando un metodo in grado di identificare segmenti di origine antica senza la necessità di fare riferimento a genomi antichi sequenziati, gli autori hanno costruito mappe dell'origine genomica delle popolazioni precedentemente elencate. La loro analisi ha rivelato segmenti di origine antica sconosciuta ad alta frequenza.

I risultati mostrano un contributo significativo di origine antica alla formazione del pool genetico delle moderne popolazioni dell'Africa occidentale. Ma sul grafico, un'impurità della popolazione antica era prima che la gente lasciasse l'Africa.

Una recente interpretazione dell'impurità che i ricercatori hanno documentato è che le forme arcaiche sono persistite in Africa fino a tempi relativamente recenti. D'altra parte, una popolazione antica poteva in precedenza fornire un contributo genetico alla popolazione umana moderna, che è stata poi incrociata con gli antenati delle popolazioni analizzate in questo studio. Sebbene questi modelli non si escludano a vicenda, è probabile che la storia degli africani includa contributi genetici da molte popolazioni diverse, come evidenziato dalla grande dimensione effettiva della popolazione, che è geneticamente correlata all'arcaico. Mentre gli umani anatomicamente moderni compaiono nei reperti fossili circa 200 mila anni fa, fossili relativamente giovani con una combinazione di arcaiche e moderne caratteristiche anatomiche sono stati trovati nell'Africa sub-sahariana e nel Medio Oriente.

Esempi di tali fossili sono un teschio di Ivo Eleru, nel sud-ovest della Nigeria, 13 mila anni e resti umani di Ishango nella moderna Repubblica Democratica del Congo, sovvenzionati per circa 20 mila anni, che non si adattano alla variabilità dell'uomo moderno. E questo può indicare che relativamente recentemente persone diverse da quelle moderne hanno vagato per l'Africa e hanno contribuito alla diversità genomica degli africani, dimostrando la complessa storia dell'interazione delle persone moderne e arcaiche in Africa. Anche le popolazioni non africane presentano miscele simili, suggerendo che un componente di origine arcaica era presente prima della separazione delle popolazioni africane e non africane. Una comprensione dettagliata delle impurità genetiche arcaiche e il loro ruolo nell'adattarsi alle diverse condizioni ambientali richiederà un'analisi dei genomi moderni e antichi in tutta la gamma geografica dell'Africa.

Antenati di Neanderthal e Denisovans si incrociarono con lontani parenti di persone

Gli autori di questo lavoro "scavarono" ancora più in profondità dei precedenti, centinaia di migliaia di anni fa, quando rappresentanti del genere di persone con un cervello più grande compaiono nei fossili dell'Europa insieme a strumenti di pietra acheuleana. Vi è disaccordo su come interpretare questi primi europei. Alcuni li vedono come gli antenati comuni della gente moderna e dei Neanderthal, altri come un vicolo cieco evolutivo, che in seguito furono sostituiti da immigrati dall'Africa, e altri ancora come i primi rappresentanti del lignaggio di Neanderthal. Le nuove stime sono più coerenti con le ultime di queste visualizzazioni. Immaginano che 600 mila anni fa, i Neanderthal erano già una linea separata, separata non solo dalla linea della gente moderna, ma anche dai Denisovani. Questi risultati risolvono le contraddizioni con i fossili dell'uomo di Heidelberg di Sima de los Huesos, originariamente datati almeno 350 mila anni fa. I dati genetici hanno mostrato che erano rappresentanti di una precedente popolazione di antenati prima dei Neanderthal e, quindi, dopo la separazione di Neanderthal e Denisovans. Tuttavia, i dati genetici indicano che questa divisione si è verificata circa 381 mila anni fa. Ciò era difficile da conciliare con l'età stimata dei fossili di Sima de los Huesos, ma la discrepanza aumentò in seguito, poiché i migliori metodi di datazione mostrarono l'età dei fossili, circa 600 mila anni e molto più antica della data molecolare della separazione dei Denisovani e dei Neanderthal. Questa discrepanza è in parte dovuta a varie calibrazioni della velocità delle mutazioni. I ricercatori del Dipartimento di Antropologia, Università dello Utah, hanno anche notato che i nuovi numeri di Neanderthal sono diversi da quelli che hanno pubblicato nel 2017 e che sono stati criticati dai loro colleghi. A proposito, questo è un buon esempio di scienziati che riconoscono i loro errori. Secondo le nuove stime degli autori dello studio, questo conflitto si risolve trasferendo la data della separazione ben oltre l'età dei fossili di Sima de los Huesos, usando genomi di genoma superiore dalla grotta Neanderthal di Vindia nella Croazia moderna, così come l'uomo Altai Denisovan e Neanderthal. Allo stesso tempo, i Neanderthal che condividevano il loro DNA con gli europei moderni erano geneticamente più simili a un Neanderthal della Grotta di Vindia che a un Neanderthal della Grotta di Denisova. Vale la pena notare che diversi Neanderthal vivevano in Altai. Relativamente vicino alla grotta Denisova, si trova la grotta Chagyrska, dove vivevano i Neanderthal della seconda ondata di insediamenti, che differivano dai loro più antichi vicini, sia nell'industria della pietra che geneticamente.

La nuova ricostruzione include tre ondate della migrazione della razza umana dall'Africa all'Eurasia:

1. Migrazione del primo Homo o popolazione "super antica" circa 1,9 milioni di anni fa. Ciò che coincide con la datazione degli ominidi Dmanis.

2. Migrazione circa 700 mila anni fa della linea ancestrale di Neanderthal e Denisovan prima della loro separazione. Per semplicità, i ricercatori hanno chiamato questa popolazione, combinando due parole: Neanderthal e Denisovans. Per noi, è qualcosa come "Neanders".

3. La migrazione delle persone moderne circa 50 mila anni fa.

Allo stesso tempo, i risultati mostrano che i Neanderd si incrociarono con i rappresentanti della popolazione antichissima all'inizio del Pleistocene Medio, poco dopo il loro arrivo in Eurasia. Molto probabilmente erano eretti eurasiatici. Questa è la prima miscela nota tra le popolazioni del genere umano. Inoltre, queste due popolazioni erano più distanti tra loro rispetto alle altre popolazioni di quelli attualmente conosciuti che si incrociavano. Sono stati divisi per origine in 1,2 milioni di anni. Più tardi, quando i rappresentanti della popolazione "super-antica" di persone si scambiarono geni con Denisovans, queste due popolazioni furono ancor più separate nel tempo. Per fare un confronto, Neanderthal e Denisovans, che hanno incrociato persone moderne, erano distanti meno di 700 mila anni. È probabile che le persone "super antiche" discendessero dalla popolazione originaria di persone in Eurasia, il cui numero stimato era compreso tra 20 e 50 mila persone. Una tale dimensione indica che questa popolazione includeva almeno due sottogruppi profondamente divisi, uno dei quali è mescolato con Neanders e l'altro con Denis. I ricercatori suggeriscono che circa 700 mila anni fa, i Neanderseans lasciarono l'Africa per l'Eurasia, sperimentarono l'effetto di un collo di bottiglia o una riduzione del pool genetico, attraversato con antiche popolazioni di persone dell'Eurasia che vivevano lì da più di un milione di anni, e poi in gran parte li sostituirono a loro volta diviso in sottopopolazioni orientali e occidentali - Denisovans e Neanderthals. Eventi simili si sono verificati 50 mila anni fa, quando le persone anatomicamente moderne hanno lasciato l'Africa e hanno sostituito Neanderthal e Denisovans..

Questo lavoro è anche degno di nota in quanto dimostra quanto tempo è necessario affinché le popolazioni isolate di persone possano ancora incrociarsi. Si scopre che almeno 1,2 milioni di anni nelle stesse condizioni.

In conclusione, voglio concentrarmi sul fatto che tutti i lavori citati sono stati pubblicati con una breve pausa quest'anno. Pertanto, immagina quante informazioni appaiono in diverse aree della scienza ogni mese..